ID: 926523050_926523055

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 926523050 926523055
Species Human (GRCh38) Human (GRCh38)
Location 2:13941851-13941873 2:13941884-13941906
Sequence CCATCTGGTGGACCATCAGGCCT TATGACTTTAGTGATAGGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 24, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!