ID: 926580951_926580965

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 926580951 926580965
Species Human (GRCh38) Human (GRCh38)
Location 2:14632741-14632763 2:14632793-14632815
Sequence CCAGTGGGAGCAGGCGCCCCGGC GCACCGCACGATTCGGCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 197} {0: 1, 1: 0, 2: 0, 3: 0, 4: 10}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!