ID: 926620644_926620652

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 926620644 926620652
Species Human (GRCh38) Human (GRCh38)
Location 2:15043827-15043849 2:15043858-15043880
Sequence CCTTGGAGGGTGCCTTCTGACTC ACTAGCCTGCCAGGGCTCCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 27, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!