ID: 926641921_926641927

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 926641921 926641927
Species Human (GRCh38) Human (GRCh38)
Location 2:15246216-15246238 2:15246237-15246259
Sequence CCTTTCTTAGGCCTTTGCCTGTG TGTTTCTGGAATCAGTGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 343} {0: 1, 1: 0, 2: 1, 3: 19, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!