ID: 926698779_926698791

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 926698779 926698791
Species Human (GRCh38) Human (GRCh38)
Location 2:15788716-15788738 2:15788758-15788780
Sequence CCCGGATGCCTCACTCTGGTGGC TGGTGTGGAGACGGGGGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 94, 4: 1603}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!