ID: 926718607_926718621

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 926718607 926718621
Species Human (GRCh38) Human (GRCh38)
Location 2:15942668-15942690 2:15942697-15942719
Sequence CCAGCGCCCGTGCCCGCAGCCCC TGCCCCGGCGGCGGGCCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 96, 4: 673} {0: 1, 1: 0, 2: 1, 3: 15, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!