ID: 926743236_926743238

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 926743236 926743238
Species Human (GRCh38) Human (GRCh38)
Location 2:16129337-16129359 2:16129354-16129376
Sequence CCACATCTATGGTCTTGTCTCTT TCTCTTCTCTGCCTTGGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!