ID: 926773166_926773174

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 926773166 926773174
Species Human (GRCh38) Human (GRCh38)
Location 2:16396397-16396419 2:16396436-16396458
Sequence CCCAGACCCTGGAGCCCGCAAAA AGGGAAAATCCCTCCTGTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 17, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!