ID: 926801793_926801807

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 926801793 926801807
Species Human (GRCh38) Human (GRCh38)
Location 2:16665790-16665812 2:16665840-16665862
Sequence CCGCCCTGCTCTGCCGCCCGCTC GGCCGCCGCAGCCTGCGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 55, 4: 571} {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!