ID: 926873008_926873014

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 926873008 926873014
Species Human (GRCh38) Human (GRCh38)
Location 2:17444188-17444210 2:17444223-17444245
Sequence CCAGTGAATGCAATAAAATGAAA GAGGAAAAGGAGAATGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 44, 3: 482, 4: 3024}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!