ID: 926883514_926883523

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 926883514 926883523
Species Human (GRCh38) Human (GRCh38)
Location 2:17575121-17575143 2:17575169-17575191
Sequence CCCAGCCTATTAAACTTTTTGTA TCCTTCTGGATTGCAGGTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 751} {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!