ID: 926886922_926886925

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 926886922 926886925
Species Human (GRCh38) Human (GRCh38)
Location 2:17606466-17606488 2:17606507-17606529
Sequence CCAGGAGGCTGAGGGTCTGACAG AGGTTCCTTGTTGACAGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 354} {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!