ID: 926886926_926886929

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 926886926 926886929
Species Human (GRCh38) Human (GRCh38)
Location 2:17606512-17606534 2:17606535-17606557
Sequence CCTTGTTGACAGCACTGGAGTTG AGTCAGAAGAAAACCAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166} {0: 1, 1: 1, 2: 7, 3: 37, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!