ID: 926887279_926887294

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 926887279 926887294
Species Human (GRCh38) Human (GRCh38)
Location 2:17609873-17609895 2:17609920-17609942
Sequence CCCCCACTGCCATCATCTCTACC CTTTATCCCCACATGGAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 119, 4: 1132} {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!