ID: 926887287_926887294

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 926887287 926887294
Species Human (GRCh38) Human (GRCh38)
Location 2:17609907-17609929 2:17609920-17609942
Sequence CCCACTCCCCAGCCTTTATCCCC CTTTATCCCCACATGGAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 482} {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!