|
Left Crispr |
Right Crispr |
| Crispr ID |
926888815 |
926888821 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:17621733-17621755
|
2:17621749-17621771
|
| Sequence |
CCCTCTTGTCTCTGCCTTCTGGG |
TTCTGGGTAGCTGGGATTATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 4, 3: 61, 4: 589} |
{0: 6, 1: 384, 2: 9342, 3: 78460, 4: 171646} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|