ID: 926890875_926890879

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 926890875 926890879
Species Human (GRCh38) Human (GRCh38)
Location 2:17637848-17637870 2:17637880-17637902
Sequence CCACAGACAGAATGACCTTTGCT AGGTTGACGCAGCACTTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 24, 3: 98, 4: 320} {0: 1, 1: 0, 2: 1, 3: 4, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!