ID: 926891000_926891011

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 926891000 926891011
Species Human (GRCh38) Human (GRCh38)
Location 2:17638804-17638826 2:17638853-17638875
Sequence CCTTAGGGAAAGGAATAATCAAG GCATAGGAGGGCCCCTTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 277} {0: 1, 1: 0, 2: 1, 3: 20, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!