ID: 926901149_926901164

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 926901149 926901164
Species Human (GRCh38) Human (GRCh38)
Location 2:17753529-17753551 2:17753575-17753597
Sequence CCTCTCCCGGGTGGCTGGGGGTC GAGGATGAACCCCGGAGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 214} {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!