ID: 926927156_926927161

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 926927156 926927161
Species Human (GRCh38) Human (GRCh38)
Location 2:17998726-17998748 2:17998771-17998793
Sequence CCCAATGATTAAAGGATTGTTTT AGGTTTAAACAAATGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 388} {0: 1, 1: 3, 2: 46, 3: 112, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!