ID: 926995856_926995862

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 926995856 926995862
Species Human (GRCh38) Human (GRCh38)
Location 2:18735193-18735215 2:18735225-18735247
Sequence CCATAAAACTCCTAGAAGAAAAT ACCATTCAGGACATAGGCATGGG
Strand - +
Off-target summary {0: 9, 1: 140, 2: 1479, 3: 15880, 4: 6498} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!