ID: 927053240_927053246

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 927053240 927053246
Species Human (GRCh38) Human (GRCh38)
Location 2:19349793-19349815 2:19349825-19349847
Sequence CCCTGTGTGTGTGTGTGTTCACC TGGTTGTTTTGGAGCAACCATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 21, 3: 175, 4: 1016} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!