ID: 927078943_927078946

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 927078943 927078946
Species Human (GRCh38) Human (GRCh38)
Location 2:19608976-19608998 2:19608993-19609015
Sequence CCCAATACACCTCTCATAACAAT AACAATTCCATCCCAGAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 191} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!