ID: 927146491_927146496

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 927146491 927146496
Species Human (GRCh38) Human (GRCh38)
Location 2:20169586-20169608 2:20169617-20169639
Sequence CCACAGGGACTGGTTCTTGTCCA CGCCCTCTCCAGGAAACCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!