ID: 927151263_927151277

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 927151263 927151277
Species Human (GRCh38) Human (GRCh38)
Location 2:20197841-20197863 2:20197880-20197902
Sequence CCCACAACACGACGTTGCCCATC CTGGTGGTGGGAGGTGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!