ID: 927162731_927162735

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 927162731 927162735
Species Human (GRCh38) Human (GRCh38)
Location 2:20283714-20283736 2:20283747-20283769
Sequence CCACAAAATGAAGAGGTATTTTC AAACTACAGGCTATGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 313} {0: 1, 1: 0, 2: 1, 3: 14, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!