ID: 927206631_927206635

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 927206631 927206635
Species Human (GRCh38) Human (GRCh38)
Location 2:20615289-20615311 2:20615304-20615326
Sequence CCACAGAACCTGGCTGCTGCTTC GCTGCTTCACAGGATGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 455} {0: 1, 1: 0, 2: 4, 3: 23, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!