ID: 927210936_927210946

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 927210936 927210946
Species Human (GRCh38) Human (GRCh38)
Location 2:20638627-20638649 2:20638662-20638684
Sequence CCCTGCAGCCCCTGGGGATCTGG AAGACAGAAAAGAATGGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 34, 4: 350} {0: 1, 1: 0, 2: 6, 3: 88, 4: 769}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!