ID: 927215840_927215846

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 927215840 927215846
Species Human (GRCh38) Human (GRCh38)
Location 2:20667401-20667423 2:20667425-20667447
Sequence CCAGGCTGCGGGCGCCGCGGCTG CCCGGCCGCCGCGGTTCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 389} {0: 1, 1: 0, 2: 3, 3: 20, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!