ID: 927231109_927231111

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 927231109 927231111
Species Human (GRCh38) Human (GRCh38)
Location 2:20825026-20825048 2:20825073-20825095
Sequence CCTTAATTTGCCTGTAATTAAAA CTGCCTTTCAGATGCTACTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 85, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!