ID: 927241494_927241502

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 927241494 927241502
Species Human (GRCh38) Human (GRCh38)
Location 2:20923346-20923368 2:20923379-20923401
Sequence CCCTAGGAGAAAGAAAGTAAAGA CAGGTGGGACATTTTGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 620} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!