ID: 927264605_927264607

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 927264605 927264607
Species Human (GRCh38) Human (GRCh38)
Location 2:21130855-21130877 2:21130907-21130929
Sequence CCTTGATCTAGCAGTAAAAATGA TGTCTTTTTAATATTCCATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 295} {0: 1, 1: 0, 2: 6, 3: 43, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!