ID: 927327347_927327351

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 927327347 927327351
Species Human (GRCh38) Human (GRCh38)
Location 2:21820389-21820411 2:21820424-21820446
Sequence CCTCACAGTTCTGGAATCTGAAC GTGCCGGTCTGGTTGTTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 431} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!