ID: 927336890_927336897

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 927336890 927336897
Species Human (GRCh38) Human (GRCh38)
Location 2:21935507-21935529 2:21935560-21935582
Sequence CCTATTGAGAATTGGTGAATAAG AGGCACCCATCACCACCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 142} {0: 1, 1: 0, 2: 2, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!