ID: 927376163_927376168

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 927376163 927376168
Species Human (GRCh38) Human (GRCh38)
Location 2:22417219-22417241 2:22417259-22417281
Sequence CCCGAGACTGGGTAATTTATAAA GTCTCACAGTTCCACGTGGCTGG
Strand - +
Off-target summary No data {0: 4, 1: 629, 2: 4728, 3: 7886, 4: 8230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!