ID: 927409040_927409047

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 927409040 927409047
Species Human (GRCh38) Human (GRCh38)
Location 2:22804611-22804633 2:22804640-22804662
Sequence CCCAGGTCCTTGAGAAAGACATT CTGTGAAAGTGGCAAGAGGCTGG
Strand - +
Off-target summary {0: 36, 1: 95, 2: 138, 3: 205, 4: 400} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!