ID: 927476962_927476971

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 927476962 927476971
Species Human (GRCh38) Human (GRCh38)
Location 2:23420861-23420883 2:23420904-23420926
Sequence CCCCACCCAAATTATACCCAACC TCACACCCTCCCAGAAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 155} {0: 1, 1: 0, 2: 1, 3: 38, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!