ID: 927476965_927476971

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 927476965 927476971
Species Human (GRCh38) Human (GRCh38)
Location 2:23420866-23420888 2:23420904-23420926
Sequence CCCAAATTATACCCAACCTTCAA TCACACCCTCCCAGAAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 261} {0: 1, 1: 0, 2: 1, 3: 38, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!