ID: 927477586_927477596

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 927477586 927477596
Species Human (GRCh38) Human (GRCh38)
Location 2:23425807-23425829 2:23425857-23425879
Sequence CCTTGTACCATTTGTGAGCACTG GGCTGGGTCTCTTTCTTCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 135} {0: 1, 1: 0, 2: 2, 3: 18, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!