ID: 927486548_927486556

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 927486548 927486556
Species Human (GRCh38) Human (GRCh38)
Location 2:23492040-23492062 2:23492059-23492081
Sequence CCTTTTTCCCTCCAGTTCCTCTG TCTGGTACACTGGCCCCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 637} {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!