ID: 927490191_927490201

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 927490191 927490201
Species Human (GRCh38) Human (GRCh38)
Location 2:23516239-23516261 2:23516260-23516282
Sequence CCATGGGCACCTGCTGGGCCCGG GGGACTGGGAAGGGCTGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 472} {0: 1, 1: 0, 2: 4, 3: 61, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!