ID: 927493736_927493740

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 927493736 927493740
Species Human (GRCh38) Human (GRCh38)
Location 2:23538132-23538154 2:23538165-23538187
Sequence CCAATAAGTAGCAGAACTAGGAT TTTCTCTTGACTCGTAGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 87, 4: 427} {0: 1, 1: 0, 2: 0, 3: 28, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!