ID: 927498457_927498462

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 927498457 927498462
Species Human (GRCh38) Human (GRCh38)
Location 2:23565886-23565908 2:23565909-23565931
Sequence CCCCTCTTGGCTAGGCAGTGCGC AGGGTGAACATCACGTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} {0: 1, 1: 0, 2: 1, 3: 6, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!