ID: 927500470_927500477

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 927500470 927500477
Species Human (GRCh38) Human (GRCh38)
Location 2:23579577-23579599 2:23579595-23579617
Sequence CCCTTTTCCCTCCAGTCCCACTT CACTTCCACTGCCATAGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 586} {0: 1, 1: 0, 2: 1, 3: 28, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!