ID: 927507880_927507885

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 927507880 927507885
Species Human (GRCh38) Human (GRCh38)
Location 2:23626416-23626438 2:23626466-23626488
Sequence CCAGTGATATTTTATTTTGGCAG AGAGCTGGGCACTTAGATCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 23, 3: 112, 4: 528} {0: 1, 1: 1, 2: 0, 3: 10, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!