ID: 927515626_927515631

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 927515626 927515631
Species Human (GRCh38) Human (GRCh38)
Location 2:23670183-23670205 2:23670225-23670247
Sequence CCTGAGCTCGCGGGCTAACTGGA AAGATCACACACCCAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48} {0: 1, 1: 0, 2: 14, 3: 141, 4: 918}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!