ID: 927515944_927515956

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 927515944 927515956
Species Human (GRCh38) Human (GRCh38)
Location 2:23671780-23671802 2:23671808-23671830
Sequence CCACTTCTGGAACCTAGGGCTGC GGCTGGGGATGGAGGGCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 157} {0: 1, 1: 3, 2: 10, 3: 179, 4: 1390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!