ID: 927515947_927515956

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 927515947 927515956
Species Human (GRCh38) Human (GRCh38)
Location 2:23671792-23671814 2:23671808-23671830
Sequence CCTAGGGCTGCCCACTGGCTGGG GGCTGGGGATGGAGGGCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 40, 4: 452} {0: 1, 1: 3, 2: 10, 3: 179, 4: 1390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!