ID: 927517275_927517280

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 927517275 927517280
Species Human (GRCh38) Human (GRCh38)
Location 2:23679840-23679862 2:23679862-23679884
Sequence CCCTGGTGGTGAAGGATAAATAC CTGCTTGGCCAGATGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119} {0: 1, 1: 0, 2: 2, 3: 25, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!