ID: 927519436_927519445

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 927519436 927519445
Species Human (GRCh38) Human (GRCh38)
Location 2:23690111-23690133 2:23690128-23690150
Sequence CCCCCTCTCCTCCTGGCCATGCC CATGCCTGTGCTGAGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 69, 4: 732} {0: 1, 1: 0, 2: 1, 3: 33, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!